Skip to main content

Table 1 PCR primers for HPV testing

From: Does HPV type affect outcome in oropharyngeal cancer?

Name Sequence 5′ to 3′
GAPDH Forward GCTCATTTGCAGGGGGGAGCC
GAPDH Reverse CTGATGATCTTGAGGCTGTTG
GAPDH Probe CY5-TCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGA –BHQ2
HPV 16 Forward TTGCAGATCATCAAGAACACGTAGA
HPV 16 Reverse GTAGAGATCAGTTGTCTCTGGTTGC
HPV 16 Probe JOE-AATCATGCATGGAGATACACCTACATTGCATGA –BHQ1
HPV 18 Forward CAACCGAGCACGACAGGAACG
HPV 18 Reverse TAGAAGGTCAACCGGAATTTTCAT
HPV 18 Probe ROX-AATATTAAGTATGCATGGACCTAAGGCAACATTGCAA –BHQ2
HPV all Forward (E1) CCTATAGTACATTTAAAAGGTG
HPV all Reverse (E1) CNTGTCCAATGCCAGGTAGATG
HPV all Probe (E1) FAM-AATAGTTTAAAATGTTTAAGATATAG-BHQ1
HPV other Forward (E2) GCATTATATTGGTATAGAACAGG
HPV other Reverse (E2) TCATTRTCASATGCCCATTGYACC
  1. HPV human papillomavirus; R puRine (A or T); S Strong (C or G); Y pYrimidine (C or T).