Skip to main content

Table 1 Sequencing primers

From: Associations of FoxP3 gene polymorphisms with severe recurrent respiratory papillomatosis in Korean patients

Polymorphism Primer 5′-3′ Length (bps) AT
rs5902434 FP3-1 F CTGCTCTCCCCTACCAGATG 196 bp 56 °C
del/ATT FP3-1R CCCTGCCCATGCATTAAGTA   
rs3761548 FP3-2 F TTGTCTACTCCACGCCTCTCC 373 bp 60 °C
C/A FP3-2R TGCCTCCATCATCACCACG   
rs3761549 FP3-4 F GTCCTCTCCACAACCCAAGA 250 bp 60 °C
C/T FP3-4R CAGATTTTTCCGCCATTGAC   
rs2232365 FP3-3 F GAGGGCTTTCAAGGTGAGGA 371 bp 60 °C
G/A FP3-3R GGGAGTTGGATTGGGTGCA   
  1. bps base pairs, AT annealing temperature