Skip to main content

Table 1 Primers used for qRT-PCR

From: Simple hypertrophic tonsils have more active innate immune and inflammatory responses than hypertrophic tonsils with recurrent inflammation in children

PrimerForward (5′ → 3′)Reverse(5′ → 3′)
VP1AGTCCTCCCACGTCACTCACTGATCACTAGGGTGGCATCA
IFN-αGCCTCGCCCTTTGCTTTACTCTGTGGGTCTCAGGGAGATCA
RIG-ICTGGACCCTACCTACATCCTGGGCATCCAAAAAGCCACGG
MAVSCAGGCCGAGCCTATCATCTGGGGCTTTGAGCTAGTTGGCA
NLRP3CGTGAGTCCCATTAAGATGGAGTCCCGACAGTGGATATAGAACAGA
TLR1TGAACCTCAAGCACTTGGACCCCCATAAGTCTCTCCTAAGACCA
TLR2ATCCTCCAATCAGGCTTCTCTGGACAGGTCAAGGCTTTTTACA
TLR3TTGCCTTGTATCTACTTTTGGGGTCAACACTGTTATGTTTGTGGGT
TLR4AGACCTGTCCCTGAACCCTATCGATGGACTTCTAAACCAGCCA
TLR5TCCCTGAACTCACGAGTCTTTGGTTGTCAAGTCCGTAAAATGC
TLR7TCGTGGACTGCACAGACAAGGGTATGTGGTTAATGGTGAGGGT
TNF-αCCTCTCTCTAATCAGCCCTCTGGAGGACCTGGGAGTAGATGAG
IL-6ACTCACCTCTTCAGAACGAATTGCCATCTTTGGAAGGTTCAGGTTG
IL-1βATGATGGCTTATTACAGTGGCAAGTCGGAGATTCGTAGCTGGA
NF-κBAACAGAGAGGATTTCGTTTCCGTTTGACCTGAGGGTAAGACTTCT
IL-7TTCCTCCCCTGATCCTTGTTCCTTGCGAGCAGCACGGAATA
IL-10GACTTTAAGGGTTACCTGGGTTGTCACATGCGCCTTGATGTCTG
IL-12ACCTTGCACTTCTGAAGAGATTGAACAGGGCCATCATAAAAGAGGT
IL-17AAGATTACTACAACCGATCCACCTGGGGACAGAGTTCATGTGGTA
IL-18TCTTCATTGACCAAGGAAATCGGTCCGGGGTGCATTATCTCTAC
COX2GAATCATTCACCAGGCAAATTTCTGTACTGCGGGTGGAACA
EP1ACCTTCTTTGGCGGCTCTCCCAACACCAGCATTGGGCT
EP2GCTCCTTGCCTTTCACGATTTAGGATGGCAAAGACCCAAGG
EP3AGCTTATGGGGATCATGTGCTTTCTGCTTCTCCGTGTGTG
EP4CGCTCGTGGTGCGAGTATTAGGGGTCTAGGATGGGGTTC
GAPDHCGCTCTCTGCTCCTCCTGTTCATGGGTGGAATCATATTGG